WordPress database error: [Table 'db_dom986782.wp_15mgqvggt3_yoast_indexable_hierarchy' doesn't exist] SELECT `ancestor_id` FROM `wp_15mgqvggt3_yoast_indexable_hierarchy` WHERE `indexable_id` = '0' ORDER BY `depth` DESC
WordPress database error: [Table 'db_dom986782.wp_15mgqvggt3_yoast_indexable_hierarchy' doesn't exist] SELECT `ancestor_id` FROM `wp_15mgqvggt3_yoast_indexable_hierarchy` WHERE `indexable_id` = '0' ORDER BY `depth` DESC
WordPress database error: [Table 'db_dom986782.wp_15mgqvggt3_yoast_indexable' doesn't exist] SELECT * FROM `wp_15mgqvggt3_yoast_indexable` WHERE `object_id` = '435' AND `object_type` = 'post' LIMIT 1
WordPress database error: [Table 'db_dom986782.wp_15mgqvggt3_yoast_indexable' doesn't exist] SELECT * FROM `wp_15mgqvggt3_yoast_indexable` WHERE `object_id` = '435' AND `object_type` = 'post' LIMIT 1
Intact Genomics is your resource for in vitro gene editing using Cas12a enzyme. We understand your need to generate sufficient quantities of sgRNA for in vitro gene editing projects. The IG® sgRNA synthesis kits are simple to use, and our kits are scalable to help you reach these goals. The IG® sgRNA synthesis kit for Cas12a Nuclease can be purchased with or without the sgRNA purification kit.
Benefits
IG® sgRNA Synthesis Kits are a perfect choice for a variety of sgRNA synthesis needs. Below is a sampling of some of the key benefits.
IG® sgRNA Synthesis Kit for Cas12a Nuclease includes everything but your targeting oligo (all buffers, enzymes, scaffolds)
User simply needs to provide the oligo for your target—Must be 32-38 base pairs and generated using the template design in this manual.
Rapid Workflow (Less than 1 hour)
Scalable Yield (just 1 reaction for all the sgRNA you need)
Customer support – our team is available to aid with your success.
The process of sgRNA synthesis by in vitro transcription (IVT) is intricate but allows for successful creation of longer sgRNAs (e.g. 100 or more nt) that cannot be easily chemically synthesized and purified at a low cost.
sgRNA synthesis can often be complicated and the maximum yield of sgRNA depends on the oligo target. Despite this complexity, it is important to use sufficient sgRNA to demonstrate the efficiency of in vitro DNA cutting for your gene editing. The IG® sgRNA synthesis kit solves this issue by providing at least 10µg of sgRNA per reaction (100 µl), enough for in vitro DNA cleavage/editing in most cases. Various competitors’ kits can only claim production of a minimum of 4µg of RNA. The increased yield from the IG® sgRNA synthesis kits will enhance your chances of experimental success. This kit provides large sgRNA synthesis volumes to get more yield.
For successful sgRNA Synthesis, scientists on your team need simply to identify a DNA modification target of interest and order unique primers targeting that sequence. From there, our team provides a simple workflow to quickly complete sgRNA synthesis, so that you may progress to gene editing using IG® Cas enzymes.
Intact Genomics is with you every step of the way to complete your projects. We offer expert advice, fast ordering and delivery, and product customization.
Components and Storage
IG® Cas12a sgRNA Synthesis Kits contains the items below. Store all components at -20°C.
IG® Cas12a sgRNA Enzyme Mix (10X)
IG® sgRNA Reaction Mix, S. pyogenes (4X)
DNase I (RNase-free, 2 Units/uL)
IG® sgRNA Control Oligo, S. pyogenes (1 uM)
Dithiothreitol (DTT, 0.2 M)
NTPs mix (25 mM)
Items needed but not provided in this kit:
Nuclease Free Water
Custom 32-38 base nucleotide oligo (see protocol tab for instructions for designing your oligo)
Nuclease-free pipette tips and microcentrifuge tubes
Step 1: Design your custom 32-38-nucleotide oligo to use the IG®sgRNA synthesis kit for Cas12a Nuclease
These steps will help to design the sequence of the target DNA oligos needed to use the kit. These oligos are not included and should be ordered and manufactured separately to use with this kit.
Use a target site selection webtool to find a 18-24 nucleotide sequence following the 5’ PAM ‘TTTV’ in your target DNA.
(ChopChop, for example). We will refer to your target sequence as “N18-24”.
Change the target sequence as a reverse complementary sequence: 5’ complementary- “N18-24”.
To the 3´ end of the complementary target: 5’ complementary- “N18-24”; append a 14 base overlap crRNA sequence in pink: 5’-ATCTACACTTAGTA-3’ to form a custom 32~38 base oligo BELOW. 5’-complementary- (“N18-24”) ATCTACACTTAGTA-3
Custom Oligo Design EXAMPLE: We use a specific sgRNA targeted sequence as an example as below:
A. Target-specific DNA sequence (24 bases) for Cas12a sgRNA is selected.
Example: 5’ TTTCCCAGTCACGACGTTGTAAAACGAC 3’
Remove these four nucleotides: the PAM sequence (TTTC, which are NOT highlighted in red) is required for Cas12a recognition of the target site and is NOT part of the sgRNA sequence as BELOW:
5’ CCAGTCACGACGTTGTAAAACGAC 3’
B. Convert the target-specific DNA sequence (24 bases) into its complementary strand DNA:
5’ GTCGTTTTACAACGTCGTGACTGG 3′
C. Append the 14 nucleotide-overlap DNA sequence shown in pink, the example DNA oligo of a total length of 38 bp is to be ordered. Shown BELOW:
5’ GTCGTTTTACAACGTCGTGACTGGATCTACACTTAGTA 3′
D. The IG® sgRNA synthesis kit for Cas12a includes an oligo shown below. This sequence includes a “G” to the 3’ end of T7 promoter sequence highlighted in blue to ensure transcription because at least one G is necessary for efficient T7 RNA polymerase binding, and the crRNA sequence in pink of Cas12a (Cpf1) and also partially overlaps with the 32~38 base oligo (pink portion):
5‘TTCTAATACGACTCACTATAGTAATTTCTACTAAGTGTAGAT 3′
When setting up the IG®sgRNA synthesis reaction, the overlapped DNA oligos are oriented as shown below:
Following completion of the incubation, the double-stranded DNA reaction product from DNA polymerase activity is shown below:
Step 2: Utilize the IG® sgRNA synthesis kit for Cas12a Nuclease
You’ve done the hard part, now let Intact Genomics make this next part easy. Simply choose whether to follow the SMALL SCALE or the PREPARATIVE SCALE table in the protocol. You’ve done the hard part, now let Intact Genomics make this next part easy. Simply choose whether to follow the SMALL SCALE or the PREPARATIVE SCALE table in the protocol.
Prewarm an incubator or water bath for microcentrifuge tubes to 37°C.
Thaw each component of the IG sgRNA synthesis kit and keep the unmixed kit reagents on ice.
Prepare a 1 µM solution of your custom oligo.
Choose to follow one of the two tables below. In a DNase/RNase-free 1.5 mL conical tube, mix the following IG® sgRNA synthesis kit components IN ORDER at room temperature. (CHOOSE either the “Small Scale” OR the “Preparative Scale”).
Mix thoroughly by tapping or flicking the tube 10 times, (do not vortex) and centrifuge the reaction droplets (for less than 5 seconds) to the bottom of the tube in a microcentrifuge. This mixture is the sgRNA synthesis reaction.
Transfer the sgRNA mixture to the prewarmed 37°C incubator for 30 minutes. The reaction is usually complete in about 25 minutes, and there are no negative effects if left for under an hour at 37°C.
Transfer the reaction to ice.
Add IG® DNase-I (RNase-Free) and Nuclease-free Water as described in the table below that matches your choice of “Small Scale” or “Preparative Scale”:
Mix thoroughly by tapping the tube 10 times and centrifuge (less than 5 seconds) all sample droplets to the bottom of the tube in a microcentrifuge.
Transfer the sgRNA mixture to the prewarmed 37°C incubator for 15 minutes.
For in vitro downstream CRISPR applications we recommend purifying the RNA using the IG® sgRNA purification kit (follow the sgRNA purification protocol) or analyzing your sgRNA by gel electrophoresis using RNase-free tips, tubes and buffers.